Introduction
There are two typical yeast
preparations, ADY (active dry yeasts) and YC (yeast cultures), in current
markets and they hey have been widely used in ruminant to maintain health and
improve growth performance and products quality
(Chaucheyras-dur et al. 2008). Nevertheless, yeast preparations did
not show a consistent conclusion for effect on animal growth performance and
production quality when it was used in ruminant animals’ production (Swyers et
al. 2014; Geng et al. 2016). The results of variation are related to
the strain of yeast, the basal diets, animal physiological state in studies and
also related to the types of yeast preparations (Geng et al. 2016). At
present, there are few studies comparing the effects of two types of yeast
preparations, ADY and YC, on animal production performance under the same
experimental conditions. We evaluated the effect of ADY (Levucell, S.
cerevisiae CNCM1-1077) and YC (Diamond V XP, Cedar Rapids, IA, U.S.A.) on
indexes of growth, carcass and beef quality in finishing beef cattle in a
previous study, and we found that both ADY and YC improved the tenderness of
beef since yeast preparations were added to the basal diets, but ADY rather
than YC had more pronounced effect on improvement of feed intake and growth
performance of beef cattle (Geng et al. 2016).
So far, the action mechanism of
yeast preparations supplementation affect feed intake and beef tenderness has
been reported (Geng et al. 2018a). The increased
circulating ghrelin concentration caused by yeasts supplementation was a key
factor for improvement of feed intake and beef tenderness (Geng et al. 2018a).
However, the further mechanism for increment of circulating
ghrelin concentration caused by yeasts supplementation is still unclear. Research
showed that changes of ghrelin concentrations were related to the changes of
ruminal fermentation production such as short chain fatty acids (SCFAs)
(Fukumori et al. 2012) and medium chain fatty acids (MCFAs) (Fukumori
et al. 2013). In addition, it was reported that some lactate-utilizing
bacteria such as S. ruminantium, M. elsdenii can synthesize MCFAs with
lactic acid as substrate (Zhu et al. 2015), and that
C. kluyveri also can synthesize efficiently MCFAs with ethanol
(Cavalcante et al. 2017).
Up to now, the effect of ADY and YC
on ruminal SCFAs has been compared in finishing cattle (Geng et al.
2018b), however, the effect on ruminal MCFAs has not been evaluated. Therefore, the purpose of this study is to lay a
foundation for revealing the mechanism of improving beef quality by
supplementation of yeast preparations by evaluating the effect of ADY and YC on
the concentration of MCFAs, lactic acid, ethanol and the abundance of relative
rumen bacteria in finishing cattle.
Materials and Methods
Animals and treatment diets
All animals were managed according
to the Yanbian University of Health guidelines for the care of animal subjects.
More detail about animal feeding and management have been reported in our
companion paper (Geng et al. 2016). Briefly, forty-five
bulls 24-month-old bulls with an average weight of 505 kg were randomly divided
into three groups, and 15 bulls in each group. There are three treatment groups
of diets in this study, which are CON group (basal diets), ADY group (basal
diets plus Levucell S. cerevisiae CNCM1–1077) and YC group (basal diets
plus Diamond V XP). The supplementation was 0.8 g/head/day for ADY and 50
g/head/day for YC. The trial lasted over 112 days. The basal diets were
high-concentrate diets which the ratio of concentrate to forage based on a dry
matter basis was 7:3. The composition and nutrient level for the basal diets
are the same to our previous study (Geng et al. 2016).
Collection of rumen fluid
All the beef cattle were
slaughtered after the trial, and the rumen fluid of bull was sampled at
slaughter. The rumen fluid was used to determine the concentration of MCFAs,
lactic acid and ethanol, and the relative abundance of
bacteria. The MCFAs included caproate (C6:0),
caprylate (C8:0), caprate (C10:0), and laurate (C12:0), and the relative bacteria included lactic
acid-producing bacteria (S. bovis, B. fibrisolvens,
L. fermentum), lactic acid-utilizing bacteria (S. ruminantium, M. elsdenii) and C.
kluyveri.
Analyses of samples
Measurement of the concentration of MCFAs was performed on an Agilent 7890A GC-FID system equipped with a
capillary column DB-225 (10 m × 0.1 mm × 0.1 μm film thickness) and the injector and detector temperatures were
maintained at 250 and 230℃, respectively. The oven temperature was programmed
at 55℃ for 1 min and increased to 205℃ at 30℃/min in 5 min,
and at 205℃ for 1 min and increased to 230℃ at 5℃/min in 5
min and at 230℃ for 1 min. The carried gas was helium, and split ratio
was 15:1.
The measurement of lactic acid and
ethanol were performed according to method of previous reports (Barker and
Summerson 1941; Rahim and Geeso 1992). The measurement of relative abundance of
bacteria was performed by real-time quantitative PCR (RT-qPCR). Briefly, 1 mL
rumen fluid was centrifuged at 5 000 rpm/min for 3 min, then the supernatant
was discarded and bacteria were collected. A lysozyme solution (10 mg/mL) was
added to collected bacterial precipitates and incubated with rotation at 37°C for 5 min to break the cell wall of bacteria.
Then, the DNA was abstracted using QIAamp DNA Stool Mini Kit (Qiagen, Germany).
RT-qPCR was performed in ABI Real time PCR (ABI 7500) and the gene
fluorescence quantitative detection was performed with Qiagen fluorescent dye
Kit (PN. 204054, Germany). The conditions of the RT-qPCR reactions were the
same as described in previous reports (Stevenson and Weimer 2007; Chen et
al. 2016) and the Table
1: Primers sequences for bacteria RT-qPCR
|
Items |
Sequence of primers
(5’-3’) |
Product size (bp) |
|
Total bacteria |
F: CGGCAACGAGCGCAACCC |
130 |
|
R: CCATTGTAGCACGTGTGTAGCC |
||
|
S. bovis |
F: CGATACATAGCCGACCTGAG |
235 |
|
R: TAGTTAGCCGTCCCTTTCTG |
||
|
B. fibrisolvens |
F: TAACATGAGTTTGATCCTGGCTC |
136 |
|
R: CGTTACTCACCCGTCCGC |
||
|
L. fermentum |
F: AGCGAACAGGATTAGATACCC |
233 |
|
R: GATGGAACTAGATGTCAAGACC |
||
|
M. elsdenii |
F: GACCGAAACTGCGATGCTAGA |
129 |
|
R: CGCCTCAGCGTCAGTTGTC |
||
|
S. ruminantium |
F: GAGCGAACAGGATTAGATACCC |
194 |
|
R: TGCGTCGAATTAAACCACATAC |
||
|
C. kluyveri |
F: GAGGAGCAAATCTCAAAAACTGC |
400 |
|
R: CCTCCTTGGTTAGACTACGGACTT |
Table 2: Effect of ADY (active dry yeast) and YC (yeast culture) on
concentration of ruminal medium chain fatty acid, lactic acid and ethanol in
finishing beef cattle
|
Treatment‡ |
SEM |
P value |
|||
|
CON |
ADY |
YC |
|||
|
Caproate C6:0, µg/mL |
80.23b |
116.30a |
71.30b |
6.74 |
0.013 |
|
Caprylate C8:0, µg/mL |
2.24 |
2.59 |
2.34 |
0.11 |
0.470 |
|
Caprate C10:0, µg/mL |
3.10 |
2.38 |
2.71 |
0.22 |
0.452 |
|
Laurate C12:0, µg/mL |
22.08 |
15.08 |
19.62 |
1.56 |
0.187 |
|
SUM, µg/mL |
106.40ab |
134.87a |
95.47b |
7.08 |
0.064 |
|
Lactic acid, µmol/mL |
24.31a |
18.91b |
25.10a |
0.96 |
0.014 |
|
Ethanol, µmol/mL |
15.48 |
11.85 |
12.60 |
0.77 |
0.124 |
† SUM, the sum of caproate, caprylate, caprate and
laurate.
‡ Treatments includes CON group (basal diets), ADY group
(basal diets plus Levucell S. cerevisiae CNCM1–1077) and YC group (basal
diets plus Diamond V XP)
a, b Differing superscript letters (a
and b) denote significant difference (P ＜ 0.05)
primers sequences for bacteria
RT-qPCR are shown in Table 1. The total bacteria were used as the
internal reference for fluorescence quantification, and the relative fold
change was expressed using the 2-ΔΔCt calculation
(Schmittgen and Livak 2008).
Statistical Analyses
Data were analyzed in a GLM model
of S.P.S.S. 18.0 (S.P.S.S. Inc., Chicago, IL, U.S.A.). The multiple comparisons
were performed by Duncan method, and significance was determined at P ≤ 0.05 and trends of
significance were determined at P
> 0.05 to P ≤ 0.10.
Results
Effect of ADY and YC on
concentration of ruminal MCFAs, lactic acid and ethanol
Compared to the control, ADY supplementation
significantly increased caproate (C6:0) concentration (P < 0.05) and
significantly decreased lactic acid concentration (P < 0.05), and
have a tendency to increase total MCFAs content (P = 0.094) and tended
to reduce the concentration of laurate (C12:0) (P
= 0.072) and ethanol (P = 0.057) in rumen fluid. Furthermore, ADY did
not show a significant effect on caprylate (C8:0) and caprate (C10:0)
concentration (P ＞ 0.1) (Table 2). Compared to control, YC did not
affect significantly the content of total MCFAs and the concentration of
individual volatile acids (caproate, caprylate, caprate and laurate), lactic
acid and ethanol (P > 0.1) (Table 2).
Effect of ADY and YC on relative
abundance of ruminal lactic acid-producing, lactic acid-utilizing bacteria and C. kluyveri
%20455-459_files/image002.png)
Fig. 1: Effect of
active dry yeast (ADY) and yeast culture (YC) on relative abundance of ruminal
lactic acid-producing, lactic acid-utilizing bacteria in finishing beef cattle
a, b For the
same strain, differing letters denote significant difference
(P ＜ 0.05)
%20455-459_files/image004.png)
Fig. 2: Effect of
active dry yeast (ADY) and yeast culture (YC) on relative abundance of ruminal C.
kluyveri bacteria in finishing beef cattle
a, b Differing
letters denote significant difference (P ＜ 0.05)
Compared to the control, ADY supplementation
significantly decreased relative abundance of B. fibrisolvens (P
< 0.05) and significantly increased relative abundance of S. ruminantium (P < 0.05) and has no significant
effect on relative abundance of S. bovis, L. fermentum and M.
elsdenii (P > 0.1) (Fig. 1). Compared
to control, YC supplementation significantly decreased relative abundance of B.
fibrisolvens (P < 0.05) and significantly increased relative abundance of S. ruminantium (P
< 0.05) and have a tendency to increase relative abundance of S. bovis
(P = 0.053), while did not affect significantly relative abundance of L. fermentum (P
> 0.1) (Fig. 1). Compared to the control, neither ADY or
YC supplementation had a significant influence on relative
abundance of C. kluyveri (P
> 0.1) (Fig. 2).
Discussion
In this study, we first revealed the effect of two
typical yeast preparation (ADY and YC) supplementation on the concentration of
ruminal MCFAs of finishing cattle fed high-concentrate diets, and compared the
effects of ADY and YC on the concentration of ruminal lactic acid, ethanol and
the relative abundance of related bacteria under the same experimental
conditions. We found that ADY supplementation significantly increased the
concentration of caproate (C6:0), and significantly decreased the
concentration of lactic acid and the relative abundance of B. fibrisolvens, and significantly increased the relative
abundance of S. ruminantium. At the same time, it also tended to
decrease the concentration of laurate (C12:0), ethanol and tended to increase
the content of total MCFAs. However, supplementation of YC had no significant
effect on the concentration of lactic acid, ethanol, total medium chain fatty
acids and individual volatile acids including caproate (C6:0), caprylate
(C8:0), caprate (C10:0), and laurate (C12:0).
It has been reported that long-term
high-concentrate diets can significantly increase the content of lactic acid in
the rumen of beef cattle, while active yeast
preparation can reduce the concentration of lactic acid by increasing the
number of lactic acid utilizing bacteria and inhibiting lactic acid producing
bacteria (Mao et al. 2016). In this study, the effect of ADY
supplementation on lactic acid concentration was consistent with previous
reports (Mao et al. 2016), and decreased lactic acid concentration
attributed to decrease of the relative abundance of B. fibrisolvens and
increase of the relative abundance of S. ruminantium. Lynch and Martin
(2002) compared the effects of active yeast cells and their cultures on lactic
acid by rumen fermentation in vitro, and the results showed that active
yeast cells rather than yeast culture decreased significantly the concentration
of lactic acid (Lynch and Martin 2002). In this study, although YC also
significantly reduced the abundance of B. fibrisolvens and increased the
abundance of S. ruminantium, it also increased the abundance of S.
bovis, which may be a reason why YC supplementation had no a significant
influence on ruminal lactic acid.
The effect of ADY supplementation on the
concentration of caproate (C6:0) may be related to
the change of relative abundance of ruminal lactic acid utilizing bacteria. It
was reported that lactic acid utilizing bacteria could synthesize caproate
(C6:0) using lactic acid as fermentation substrate (Fukumori et al.
2013). In this study, that ADY supplementation significantly increased the
relative abundance of lactic acid utilizing bacteria S. ruminantium and
significantly decreased the concentration of lactic acid suggested that
caproate (C6:0) may be synthesized from lactic acid by S. ruminantium.
In addition, it was found that C. clarkii in rumen could produce
caproate (C6:0) using ethanol (Weimer and Stevenson 2012) and its coculture
with active Saccharomyces cerevisiae significantly increased the
production of caproate (C6:0) (Weimer et al. 2015). In this study,
although ADY supplementation did not affect significantly the relative
abundance of C. clarkii in rumen, the concentration of ethanol in rumen
was decreased, which indicated that the increase of caproate (C6:0)
concentration might be also related to the enhancement of the utilization of
ethanol by Clostridium clarkii. Moreover, laurate (C12:0) is the main
precursor of lauroylcarnitine synthesis. Ogunade et al. (2019) found
that the rumen lauroylcarnitine concentration decreased significantly after ADY
supplementation (Ogunade et al. 2019), which was consistent with the
conclusion that laurate (C12:0) concentration was decreased after ADY
supplementation in this study.
Ghrelin plays an important role in animal feeding
and meat tenderness regulation, which also explains part of the reasons for the
improvement of beef cattle performance by supplementary yeast preparation (Geng
et al. 2018a). However, the mechanism for increment of ghrelin
concentration caused by yeast preparations supplementation is still unclear. It
was found that the changes of SCFAs and MCFAs in rumen could cause the changes
of ghrelin concentration in blood of dairy cows (Fukumori et al. 2012,
2013). Rumen perfusion of short chain fatty acids significantly reduced the
blood ghrelin level of calves (Fukumori et al. 2012), while supplementation
with medium chain fatty acid calcium significantly increased the blood ghrelin
level of dairy cows (Fukumori et al. 2013). Our previous study found
that both ADY and YC significantly increased the blood ghrelin level of beef
cattle (Geng et al. 2018a), but there were significant differences in
the effects of ADY and YC on rumen short chain fatty acids (Kowalik et al.
2012; Geng et al. 2018b). ADY supplementation had no significant effect
on ruminal SCFAs, but YC significantly increased the concentration of acetic
acid and the ratio of acetic acid to propionic acid, and significantly
decreased the concentration of valeric acid (Geng et al. 2018b).
Presumably, the increase of rumen caproate (C6:0) may be a key for the increase
of ghrelin caused by ADY, and the increase of ghrelin concentration caused by
YC may be related to the change of rumen SCFAs. Further
comprehensive research is required to determine the correlation of ghrelin with
ruminal fatty acid including the types and ratio of MCFAs and SCFAs.
Conclusion
Acknowledgements
This research was supported by the National
Natural Science Foundation of China (grant no. 31660669, 32060763), Jilin
Scientific Research Planning Project of Jilin Province in 13th Five-Year (Grant
No. JJKH20180904KJ, 2018).
Author Contributions
CY
and MZ design the study. CY, SJ and YJ performed the experiments. CY and SJ
analyzed the data. CY and LY wrote the manuscript. All authors have read and approved
the manuscript.
Barker SB, WH Summerson (1941). The
colorimetric determination of lactic acid in biological material. J Biol
Chem 138:535‒554
Cavalcante WDA, RC Leitao, TA
Gehring, LT Angenent, ST Santaella (2017). Anaerobic fermentation for n-caproic
acid production: A review. Process Biochem 54:106‒119
Chaucheyras-dur F, ND Walker, A
Bach (2008). Effects of active dry yeasts on the rumen microbial ecosystem: Past,
present and future. Anim Feed Sci Technol 145:5‒26
Chen L, S Liu, HR Wang, MZ Wang, LH
Yu (2016). Relative significances of pH and substrate starch level to roles of Streptococcus bovis S1 in rumen
acidosis. AMB Exp 6:80-88
Fukumori R, T Sugino, H Shingu, N
Moriya, H Kobayashi, Y Hasegawa, M Kojima, K Kangawa, T Obitsu, S Kushibiki, K
Taniguchi (2013). Ingestion of medium chain fatty acids by lactating dairy cows
increases concentrations of plasma ghrelin. Domest Anim Endocrinol
45:216‒223
Fukumori R, T Mita, T Sugino, Y
Hasegawa, M Kojima, K Kangawa, T Obitsu, K Taniguchi (2012). Effects of glucose
and volatile fatty acids on blood ghrelin concentrations in calves before and
after weaning. J Anim Sci 90:4839‒4845
Geng CY, QX Meng, LP Ren, ZM Zhou,
M Zhang, CG Yan (2018a). Comparison of ruminal fermentation parameters, fatty
acid composition and flavor of beef in finishing bulls fed active dry yeast
active dry yeast (Saccharomyces
cerevisiae) and yeast culture. Anim Prod Sci 58:841‒847
Geng CY, S Ji, YH Jin, CY Li, GJ
Xia (2018b). Comparison of blood immunity, antioxidant capacity and hormone
indexes in finishing bulls fed active dry yeast (Saccharomyces cerevisiae) and yeast culture. Intl J Agric Biol 20:2561‒2568
Geng CY, LP Ren, ZM Zhou, Y Chang,
QX Meng (2016). Comparison of active dry yeast (Saccharomyces cerevisiae) and yeast culture for growth performance,
carcass traits, meat quality and blood indexes in finishing cattle. Anim Sci
J 87:982‒988
Kowalik B, J
Skomial, JJ Pajak, M Taciak, M Majewska, G Belzecki (2012). Population of
ciliates, rumen fermentation indicators and biochemical parameters of blood
serum in heifers fed diets supplemented with yeast (Saccharomyces cerevisiae) preparation. Anim Sci Pap Rep 30:329‒338
Lynch HA, SA Martin (2002). Effects
of saccharomyces cerevisiae culture and saccharomyces cerevisiae live cells on in vitro mixed ruminal microorganism
fermentation. J Dairy Sci 85:2603‒2608
Mao SY, WJ Huo, WY Zhu (2016).
Microbiome-metabolome analysis reveals unhealthy alterations in the composition
and metabolism of ruminal microbiota with increasing dietary grain in a goat
model. Environ Microbiol 18:525‒541
Ogunade I, H Schweickart, M McCoun,
K Cannon, C McManus, (2019). Integrating 16S rRNA Sequencing and LC–MS-Based
Metabolomics to Evaluate the Effects of Live Yeast on Rumen Function in Beef
Cattle. Animals 9:28-41
Rahim SA, SG Geeso (1992).
Colorimetric determination of ethanol in the presence of methanol and other
species in aqueous solution. Talanta 39:1489‒1491
Schmittgen TD, KJ Livak (2008).
Analyzing real-time PCR data by the comparative CT method. Nat Protoc 3:1101‒1108
Stevenson DM, PJ Weimer (2007).
Dominance of Prevotella and low
abundance of classical ruminal bacterial species in the bovine rumen revealed
by relative quantification real-time PCR. Appl Microbiol Biotechnol 75:165‒174
Swyers KL, JJ Wagner, KL Dorton, SL
Archibeque (2014). Evaluation of saccharomyces cerevisiae fermentation product
as an alternative to monensin on growth performance, cost of gain, and carcass
characteristics of heavy-weight yearling beef steers. J Anim Sci 2:2538‒2545
Weimer PJ, DM Stevenson (2012). Isolation, characterization, and
quantification of Clostridium kluyveri
from the bovine rumen. Appl Microbiol Biotechnol 94:461‒466
Weimer PJ, M Nerdahl, DJ Brandl (2015). Production of medium-chain
volatile fatty acids by mixed ruminal microorganisms is enhanced by ethanol in
co-culture with Clostridium kluyveri.
Bioresour Technol 175:97‒101
Zhu XY, Y Tao, C Liang, XZ Li, N Wei, WJ Zhang,
Zhou, YF Yang, T Bo (2015). The synthesis of n-caproate from lactate: A new efficient process for medium-chain
carboxylates production. Sci Rep 5; Article 14360